Biology

Identify all possible products of meiosis in plant and animal life cycles.

Multicellular adult organismsGametes (sperm and eggs)Spores i gotspores. because in my book it says meiosis in the sporophyte produces haploid cells called spores. also got gametes because it says in

What would be the most probably result of this transfusion

A patient has had a serious accident and lost a lot of blood. In an attempt to replenish body fluids, a large amount of distilled water was transferred directly into one of his veins. What will be the

What is the amino acid sequence from the given nucleotide sequence? (urgent!)

5 AUGCCGGGGAAACACAGCAGGGAAUAGCUAG 3 (Not sure how to split them up when there are 31 nucleotides?)-AUG CCG GGG AAA CAC AGC AGG GAA UAG CUA G Metionine Proline Glycine Asparagine Histidine Serine Argi

Are plant cells and leaf cells the same thing

i have to make a leaf cell models for Bio and couldnt find anyy examples online!! but i did find plant cell models. would that be the same?? thank u!(:-A leaf is a plant organ, like a heart is a human

PLEASE I need help Biology (Molecular Genetics!)

A rice breeder obtained a triple heterozygote carrying the three recessive alleles for albino flowers (al), brown awns (b), and fuzzy leaves (fu), all paired with their normal wild-type alleles. This

Is it possible to reach into somebody and rip their heart out

Would the heart still beat after you ripped it out?-Nope.Think about where you have to reach in. 1.You punch in through the ribs.Good luck getting an intact heart out like that. 2.You punch under the

Can potato cells be viewed under a microscope

If they can, what is the maximum thickness I could use for a slide to see a number of cells clearly?-Yes they can, particularly if stained with iodine solution when its possible to identify individual

Plant Cell Functions

Match the following 9 cell parts with their description of their function. Cell Parts 1. Cytoplasm 2. Cell Membrane 3. Cell Wall 4. Nucleolus 5. Ribsome 6.Golgi body 7. Lysosomes 8. Chloroplast 9.Ce

Dehydration reactions _____. They do so by _____.

A link monomers to form a polymer ... adding a water molecule B remove monomers from polymers ... adding a water molecule C link monomers to form a polymer ... removing a water molecule D remove monom

In a DNA duplex with four base-pairs, how many of each of the following chemical groups are there

Are answers correct, and can I get help with part B a. strands- Two b. deoxyribose sugars----not sure c. phosphate groups-Six d. 5 ends-Two e. purines-Four f. pyrimidines-Four-Nicely done, all answer

If there are 10 sister chromatids in a cell, which of the following is definitely true: a) The chromosomes are

If there are 10 sister chromatids in a cell, which of the following is definitely true: a) The chromosomes are completely condensed b) The mitotic spindle is fully formed c) This is not likely a human

Why do nucleotides only get added to the 3' end during DNA synthesis

I know it has something to do with hydrogen bonds...I think...just a basic question :) thanks so much!-Because DNA polymerase can only use the 3 OH as a substrate.That is the part of the nucleotide th

More eaten by herbivores, less plant diversity

What do you think? If there is more herbivory (leaves of plants eaten by herbivores), do you think there will be less plant diversity?-I disagree. The evolution of plants was driven, in part, by plan

How does the DIGESTIVE and EXCRETORY systems work together in insects to remove wastes

This is a question for biology??-Insects excrete wastes via malphigian tubules.These are very tiny tubes that out pouch from the gut wall.The tubes wave around in the body cavity fluid where the cells

Describe the use of ATP

for short-term energy storage in the cell.-ATP is used to drive most endergonic (energy requiring) processes in cells.The hydrolysis of the terminal phosphate group in ATP, converting ATP into ADP and