ACATTTGCTTCTGACACAACTGTGTTCACT
Is it the human hemoglobin gene? im not sure...
ALSO!
What is the function of DNA ligase?
Is it the human hemoglobin gene? im not sure...
ALSO!
What is the function of DNA ligase?
-
http://blast.ncbi.nlm.nih.gov/Blast.cgi?…
use this site to BLAST that sequence but since it is kind of short it will probably "hit" a lot of different genes
Ligase is used to "paste" 2 pieces of DNA together that have over lapping sequence
use this site to BLAST that sequence but since it is kind of short it will probably "hit" a lot of different genes
Ligase is used to "paste" 2 pieces of DNA together that have over lapping sequence
-
You have to be kidding. There are so many different genes that sequence could be in. It would be very difficult to figure out because genes are many base pairs long. With regards to your second question, DNA ligase binds the DNA together during DNA replication.