I need these for a science project but I can't seem to find only the first 50 bases without having to download a ton of them. Does anyone have this information or is able to find it?
-
Hi there,
So the first 50 bases of the human genome are:
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA…
I put in the reference of where I found it... But I am not sure what you want to do with this. As you may know humans have 23 pairs of chromosomes which are (pretty arbitrarily) numbered by size. Also DNA can be read in two directions... what I am trying to say is that the above are technically the first 50 bases of the human genome but they are by no means special and instead have been chosen more or less randomly from the 46 different ends our 23 chromosome pairs have.
Furthermore the ends of chromosomes are usually made up of repetitive "junk" DNA (the telomers) and do not encode any genes (and thus are not transcribed to RNA), so there is hardly any information in these 50 bases.
Almost all genomes that have been sequence can be found on the NCBI website which is where I got this sequence from.
Hope this helps, good luck!
PS: YAY, exactly what I meant.. you can find other chromosome regions or individual genes on that website as well!
So the first 50 bases of the human genome are:
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA…
I put in the reference of where I found it... But I am not sure what you want to do with this. As you may know humans have 23 pairs of chromosomes which are (pretty arbitrarily) numbered by size. Also DNA can be read in two directions... what I am trying to say is that the above are technically the first 50 bases of the human genome but they are by no means special and instead have been chosen more or less randomly from the 46 different ends our 23 chromosome pairs have.
Furthermore the ends of chromosomes are usually made up of repetitive "junk" DNA (the telomers) and do not encode any genes (and thus are not transcribed to RNA), so there is hardly any information in these 50 bases.
Almost all genomes that have been sequence can be found on the NCBI website which is where I got this sequence from.
Hope this helps, good luck!
PS: YAY, exactly what I meant.. you can find other chromosome regions or individual genes on that website as well!
-
Yeah, there's no way of defining the "first" 50 bases, partly because you have to pick a chromosome, and partly because chromosomes end in telomeres, which are highly repetitive and difficult to sequence. Probably the easiest way to get some human sequence is to use the UCSC Genome Browser, here: http://genome.ucsc.edu/cgi-bin/hgGateway
Make sure you have "human" selected, and pick a random position, and hit submit. A picture will come up of that region of the genome, with what's there. Click on "DNA" on the top, and you can get the actual DNA sequence of that region.
Make sure you have "human" selected, and pick a random position, and hit submit. A picture will come up of that region of the genome, with what's there. Click on "DNA" on the top, and you can get the actual DNA sequence of that region.